matlab v.7 r.14 Search Results


96
MathWorks Inc matlab gpu703 toolbox
Matlab Gpu703 Toolbox, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+v%2E7+r%2E14/Image+Processing+Toolbox/pm38579691-342-188-188
Average 96 stars, based on 1 article reviews
matlab gpu703 toolbox - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

86
10X Genomics resource source identifier chromium single cell 30 reagent kit v 3 1
Resource Source Identifier Chromium Single Cell 30 Reagent Kit V 3 1, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+v%2E7+r%2E14/cellranger/pm38897209-609-2-12
Average 86 stars, based on 1 article reviews
resource source identifier chromium single cell 30 reagent kit v 3 1 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

99
Oxford Instruments n a software
N A Software, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+v%2E7+r%2E14/Imaris/pm38897209-609-60-64
Average 99 stars, based on 1 article reviews
n a software - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
MathWorks Inc function lsqlin
Function Lsqlin, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+v%2E7+r%2E14/Optimization+Toolbox/pmc07555687-189-580-583
Average 96 stars, based on 1 article reviews
function lsqlin - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

86
Jackson Laboratory organisms
Organisms, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+v%2E7+r%2E14/organisms+strains/pm34343496-430-208-212
Average 86 stars, based on 1 article reviews
organisms - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory il15ratm1ama j
Il15ratm1ama J, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+v%2E7+r%2E14/il15ratm1ama+j/pm34343496-430-219-220
Average 86 stars, based on 1 article reviews
il15ratm1ama j - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

92
Biosynth Carbosynth bp10 915 diphtheria toxin sigma
Bp10 915 Diphtheria Toxin Sigma, supplied by Biosynth Carbosynth, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+v%2E7+r%2E14/Diphtheria+toxin/pm34343496-430-61-57
Average 92 stars, based on 1 article reviews
bp10 915 diphtheria toxin sigma - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

86
Tree Star Inc murine bcl2 attatcatcgtgtttttcaaag rev tagatggatcctaatcaacc fwd
Figure 3. CXCR6 supports survival of TCF-1neg CTLs in the TME to enable their anti-tumor activity (A) Culture of peptide-activated WT or Cxcr6–/– OT-I splenocytes in low rIL-2 (5 ng/mL) or in high rIL-2 (20 ng/mL) and rIL-12 (10 ng/mL) to generate TCF-1pos-like or TCF-1neg-like OT-I CTLs, respectively. (B) D4M.3A-pOVA tumor growth following i.v. injection of 106 TCF-1pos-like or TCF-1neg-like OT-I CTLs. (C) Overlaid contour plots of CXCR6 expression on tumor-infiltrating OT-I cells 4 days after injection of TCF-1pos-like (red, gated on cells that remained TCF-1pos) or TCF-1neg-like (black) cells into tumor-bearing mice on day 14. (D and E) Frequency (D) and ex vivo-stimulated IFN-g expression (E) of the same cells as shown in (C). (F) Growth of D4M.3A-pOVA tumors following i.v. injection on day 13 of 106 either WT or Cxcr6–/–TCF-1neg-like OT-Is as generated in (A) or in non-injected animals (Ctrl.). (G and H) In situ expression of granzyme B, IFN-g, and TNF (G) and ex vivo-stimulated expression of IFN-g and TNF (H) by tumor-infiltrating OT-I cells on day 4 following i.v. injection of TCF-1neg-like cells, as described for (F). (I–L) WT and Cxcr6–/– TCF-1neg-like OT-I cells were co-injected into tumor-bearing mice on day 15 and their respective frequencies and ratios in tumor tissue (J and K) and their ex vivo uptake of the viability dye ZombieRed by cells in tumors, tdLNs, and spleens (L) were assessed at the indicated time-points thereafter. (M) Ratios of tumor-infiltrating CTLs 4 days after injection of WT and Cxcr6–/– TCF-1neg-like OT-I cells (106) into animals implanted with either D4M.3A-pOVA or D4M.3A tumors into their flanks. (N and O) WT and Cxcr6–/– TCF-1neg-like OT-I cells were retrovirally transduced to express either Bcl-2 and mRFP <t>(RV-Bcl2)</t> or RFP only (RV-ctrl.) and co-injected into tumor-bearing animals on day 14. Four days later, tumor-infiltrating cells were examined for ex vivo uptake of the viability dye Viability eFluor 780 (N) and their input-corrected ratios (O). (P) Same cells as described for use in (N and O) were injected into separate tumor-bearing animals and tumor growth was monitored. *, #, and & = p < 0.05 versus WT Bcl2, Cxcr6–/– Bcl2, and WT Ctrl., respectively. Data in (A–M) represent at least two independent replicates with similar results. Graphs show means and either individual replicates or ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 in all graphs except for (B), (F), and (P).
Murine Bcl2 Attatcatcgtgtttttcaaag Rev Tagatggatcctaatcaacc Fwd, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+v%2E7+r%2E14/attatcatcgtgtttttcaaag+bcl2+fwd+murine+rev+tagatggatcctaatcaacc/pm34343496-430-264-295
Average 86 stars, based on 1 article reviews
murine bcl2 attatcatcgtgtttttcaaag rev tagatggatcctaatcaacc fwd - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory il 12 p40 yfp il12btm1 1 lky j mikael pittet laboratory jax
Figure 3. CXCR6 supports survival of TCF-1neg CTLs in the TME to enable their anti-tumor activity (A) Culture of peptide-activated WT or Cxcr6–/– OT-I splenocytes in low rIL-2 (5 ng/mL) or in high rIL-2 (20 ng/mL) and rIL-12 (10 ng/mL) to generate TCF-1pos-like or TCF-1neg-like OT-I CTLs, respectively. (B) D4M.3A-pOVA tumor growth following i.v. injection of 106 TCF-1pos-like or TCF-1neg-like OT-I CTLs. (C) Overlaid contour plots of CXCR6 expression on tumor-infiltrating OT-I cells 4 days after injection of TCF-1pos-like (red, gated on cells that remained TCF-1pos) or TCF-1neg-like (black) cells into tumor-bearing mice on day 14. (D and E) Frequency (D) and ex vivo-stimulated IFN-g expression (E) of the same cells as shown in (C). (F) Growth of D4M.3A-pOVA tumors following i.v. injection on day 13 of 106 either WT or Cxcr6–/–TCF-1neg-like OT-Is as generated in (A) or in non-injected animals (Ctrl.). (G and H) In situ expression of granzyme B, IFN-g, and TNF (G) and ex vivo-stimulated expression of IFN-g and TNF (H) by tumor-infiltrating OT-I cells on day 4 following i.v. injection of TCF-1neg-like cells, as described for (F). (I–L) WT and Cxcr6–/– TCF-1neg-like OT-I cells were co-injected into tumor-bearing mice on day 15 and their respective frequencies and ratios in tumor tissue (J and K) and their ex vivo uptake of the viability dye ZombieRed by cells in tumors, tdLNs, and spleens (L) were assessed at the indicated time-points thereafter. (M) Ratios of tumor-infiltrating CTLs 4 days after injection of WT and Cxcr6–/– TCF-1neg-like OT-I cells (106) into animals implanted with either D4M.3A-pOVA or D4M.3A tumors into their flanks. (N and O) WT and Cxcr6–/– TCF-1neg-like OT-I cells were retrovirally transduced to express either Bcl-2 and mRFP <t>(RV-Bcl2)</t> or RFP only (RV-ctrl.) and co-injected into tumor-bearing animals on day 14. Four days later, tumor-infiltrating cells were examined for ex vivo uptake of the viability dye Viability eFluor 780 (N) and their input-corrected ratios (O). (P) Same cells as described for use in (N and O) were injected into separate tumor-bearing animals and tumor growth was monitored. *, #, and & = p < 0.05 versus WT Bcl2, Cxcr6–/– Bcl2, and WT Ctrl., respectively. Data in (A–M) represent at least two independent replicates with similar results. Graphs show means and either individual replicates or ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 in all graphs except for (B), (F), and (P).
Il 12 P40 Yfp Il12btm1 1 Lky J Mikael Pittet Laboratory Jax, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+v%2E7+r%2E14/12+1lky+il+il12btm1+j+jax+laboratory+mikael+p40+pittet+yfp/pm34343496-430-243-249
Average 86 stars, based on 1 article reviews
il 12 p40 yfp il12btm1 1 lky j mikael pittet laboratory jax - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results


Figure 3. CXCR6 supports survival of TCF-1neg CTLs in the TME to enable their anti-tumor activity (A) Culture of peptide-activated WT or Cxcr6–/– OT-I splenocytes in low rIL-2 (5 ng/mL) or in high rIL-2 (20 ng/mL) and rIL-12 (10 ng/mL) to generate TCF-1pos-like or TCF-1neg-like OT-I CTLs, respectively. (B) D4M.3A-pOVA tumor growth following i.v. injection of 106 TCF-1pos-like or TCF-1neg-like OT-I CTLs. (C) Overlaid contour plots of CXCR6 expression on tumor-infiltrating OT-I cells 4 days after injection of TCF-1pos-like (red, gated on cells that remained TCF-1pos) or TCF-1neg-like (black) cells into tumor-bearing mice on day 14. (D and E) Frequency (D) and ex vivo-stimulated IFN-g expression (E) of the same cells as shown in (C). (F) Growth of D4M.3A-pOVA tumors following i.v. injection on day 13 of 106 either WT or Cxcr6–/–TCF-1neg-like OT-Is as generated in (A) or in non-injected animals (Ctrl.). (G and H) In situ expression of granzyme B, IFN-g, and TNF (G) and ex vivo-stimulated expression of IFN-g and TNF (H) by tumor-infiltrating OT-I cells on day 4 following i.v. injection of TCF-1neg-like cells, as described for (F). (I–L) WT and Cxcr6–/– TCF-1neg-like OT-I cells were co-injected into tumor-bearing mice on day 15 and their respective frequencies and ratios in tumor tissue (J and K) and their ex vivo uptake of the viability dye ZombieRed by cells in tumors, tdLNs, and spleens (L) were assessed at the indicated time-points thereafter. (M) Ratios of tumor-infiltrating CTLs 4 days after injection of WT and Cxcr6–/– TCF-1neg-like OT-I cells (106) into animals implanted with either D4M.3A-pOVA or D4M.3A tumors into their flanks. (N and O) WT and Cxcr6–/– TCF-1neg-like OT-I cells were retrovirally transduced to express either Bcl-2 and mRFP (RV-Bcl2) or RFP only (RV-ctrl.) and co-injected into tumor-bearing animals on day 14. Four days later, tumor-infiltrating cells were examined for ex vivo uptake of the viability dye Viability eFluor 780 (N) and their input-corrected ratios (O). (P) Same cells as described for use in (N and O) were injected into separate tumor-bearing animals and tumor growth was monitored. *, #, and & = p < 0.05 versus WT Bcl2, Cxcr6–/– Bcl2, and WT Ctrl., respectively. Data in (A–M) represent at least two independent replicates with similar results. Graphs show means and either individual replicates or ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 in all graphs except for (B), (F), and (P).

Journal: Cell

Article Title: CXCR6 positions cytotoxic T cells to receive critical survival signals in the tumor microenvironment.

doi: 10.1016/j.cell.2021.07.015

Figure Lengend Snippet: Figure 3. CXCR6 supports survival of TCF-1neg CTLs in the TME to enable their anti-tumor activity (A) Culture of peptide-activated WT or Cxcr6–/– OT-I splenocytes in low rIL-2 (5 ng/mL) or in high rIL-2 (20 ng/mL) and rIL-12 (10 ng/mL) to generate TCF-1pos-like or TCF-1neg-like OT-I CTLs, respectively. (B) D4M.3A-pOVA tumor growth following i.v. injection of 106 TCF-1pos-like or TCF-1neg-like OT-I CTLs. (C) Overlaid contour plots of CXCR6 expression on tumor-infiltrating OT-I cells 4 days after injection of TCF-1pos-like (red, gated on cells that remained TCF-1pos) or TCF-1neg-like (black) cells into tumor-bearing mice on day 14. (D and E) Frequency (D) and ex vivo-stimulated IFN-g expression (E) of the same cells as shown in (C). (F) Growth of D4M.3A-pOVA tumors following i.v. injection on day 13 of 106 either WT or Cxcr6–/–TCF-1neg-like OT-Is as generated in (A) or in non-injected animals (Ctrl.). (G and H) In situ expression of granzyme B, IFN-g, and TNF (G) and ex vivo-stimulated expression of IFN-g and TNF (H) by tumor-infiltrating OT-I cells on day 4 following i.v. injection of TCF-1neg-like cells, as described for (F). (I–L) WT and Cxcr6–/– TCF-1neg-like OT-I cells were co-injected into tumor-bearing mice on day 15 and their respective frequencies and ratios in tumor tissue (J and K) and their ex vivo uptake of the viability dye ZombieRed by cells in tumors, tdLNs, and spleens (L) were assessed at the indicated time-points thereafter. (M) Ratios of tumor-infiltrating CTLs 4 days after injection of WT and Cxcr6–/– TCF-1neg-like OT-I cells (106) into animals implanted with either D4M.3A-pOVA or D4M.3A tumors into their flanks. (N and O) WT and Cxcr6–/– TCF-1neg-like OT-I cells were retrovirally transduced to express either Bcl-2 and mRFP (RV-Bcl2) or RFP only (RV-ctrl.) and co-injected into tumor-bearing animals on day 14. Four days later, tumor-infiltrating cells were examined for ex vivo uptake of the viability dye Viability eFluor 780 (N) and their input-corrected ratios (O). (P) Same cells as described for use in (N and O) were injected into separate tumor-bearing animals and tumor growth was monitored. *, #, and & = p < 0.05 versus WT Bcl2, Cxcr6–/– Bcl2, and WT Ctrl., respectively. Data in (A–M) represent at least two independent replicates with similar results. Graphs show means and either individual replicates or ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 in all graphs except for (B), (F), and (P).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER DNASE I recombinant Sigma-Aldrich Cat# 4536282001 Qtracker 655 Vascular Labels Invitrogen Cat# Q21021MP Recombinant Mouse IL-12 Protein R&D Cat# 419-ML-010 Recombinant Mouse IL-2 Protein Zhirui Wang Laboratory Cat# RP-13 Recombinant Mouse IL-15 Protein R&D Cat# 447-ML-010 Recombinant Mouse IFN-g Protein R&D Cat# 485-ML-100 Recombinant Murine CXCL16 Protein PeproTech Cat# 250-28 SIINFEKL peptide New England Peptide Cat# BP10-915 Diphtheria Toxin Sigma Cat# D0564-1MG Critical Commercial Assays APC Annexin V Apoptosis Detection Kit with 7-AAD BioLegend Cat# 640930 Naive CD8a+ T Cell Isolation Kit Miltenyi CSt# 130-096-543 Zombie Red Fixable Viability Kit BioLegend Cat# 423110 Fixable Viability Dye eFluor 780 Thermo Fisher Scientific Cat# 65-0865-14 Foxp3 / Transcription Factor Staining Buffer Set Thermo Fisher Scientific Cat# 00-5523-00 CellTrace Far Red Cell Proliferation Kit Thermo Fisher Scientific Cat# C34564 DY-396XL NHS-ester Dyomics 396XL-01A Deposited Data scRNA-Seq of D4M3A-pOVA melanoma in C57BL/6 mice This paper GEO: GSE179111 scRNA-Seq of KP1.9 lung adenocarcinoma in C57BL/6 mice Zilionis et al., 2019 GEO: GSE127465 Experimental Models: Cell Lines BRAFV600E x PTENnull D4M.3A-H2B-Cerulean Di Pilato et al., 2019 N/A BRAFV600E x PTENnull D4M.3A-H2BCerulean-SIINFEKL Di Pilato et al., 2019 N/A BRAFV600E x PTENnull D4M.3A-H2BCerulean-SIINFEKL CXCL16 / This paper N/A LLC1 (LL/2) Andrew Luster laboratory N/A YUMM1.1 Marcus Bosenberg laboratory N/A Experimental Models: Organisms/Strains Mouse: WT: C57BL/6/J The Jackson Laboratory Jax: 000664 Mouse: Il15ra–/–: Il15ratm1Ama/J The Jackson Laboratory Jax: 003723 Mouse: Cxcr6–/–: Cxcr6 tm1Litt/J Fidel Zavala Laboratory Jax: 005693 Mouse: Cxcr6–/– x OT-I Fidel Zavala Laboratory N/A Mouse: IL-12 p40-YFP: Il12btm1.1Lky/J Mikael Pittet Laboratory Jax: 006412 Mouse: mRFP+ x OT-I Ulrich von Andrian Laboratory N/A Oligonucleotides Primers to amplify murine Bcl2: ATTATCATCGTGTTTTTCAAAG (Rev) TAGATGGATCCTAATCAACC (Fwd) This paper N/A Recombinant DNA pSFFV-neo Bcl2 plasmid Zha et al., 1996 Addgene Plasmid #8776 Software and Algorithms Prism 8 Graphpad https://www.graphpad.com/ FlowJo version 10.5.3 Treestar https://www.flowjo.com/ ImageJ Freeware/NIH https://imagej.nih.gov/ij/ Imaris 9.5 Bitplane https://imaris.oxinst.com/ MATLAB Mathworks https://it.mathworks.com/ (Continued on next page) ll e4 Cell 184, 4512–4530.e1–e10, August 19, 2021 Article

Techniques: Activity Assay, Injection, Expressing, Ex Vivo, Generated, In Situ